Skip to main content

pCAG-human SLC9C1-3xFlag
(Plasmid #249411)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 249411 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG1.1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SLC9C1
  • Species
    H. sapiens (human)
  • Entrez Gene
    SLC9C1 (a.k.a. NHE, NHE-10, SLC9A10, sperm-NHE)
  • Promoter CAG
  • Tag / Fusion Protein
    • 3xFLAG (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer GCCTTCTTCTTTTTCCTACAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The SLC9C1 insert was derived from pDONR221_SLC9C1 (Addgene Plasmid 132247)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-human SLC9C1-3xFlag was a gift from Masahito Ikawa (Addgene plasmid # 249411 ; http://n2t.net/addgene:249411 ; RRID:Addgene_249411)
  • For your References section:

    Formation of a complex between TMEM217 and the sodium-proton exchanger SLC9C1 is crucial for mouse sperm motility and male fertility. Iida-Norita R, Miyata H, Ninomiya A, Emori C, Kamoshita M, Pan C, Wang H, Ikawa M. Proc Natl Acad Sci U S A. 2025 Oct 21;122(42):e2513924122. doi: 10.1073/pnas.2513924122. Epub 2025 Oct 15. 10.1073/pnas.2513924122 PubMed 41091759