pX459-TMEM217-gRNA#1
(Plasmid
#249417)
-
PurposepX459-gRNA#1 targeting the 5′ coding region of human TMEM217
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249417 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepx459
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTMEM217
-
gRNA/shRNA sequenceGAACAGAAGCACCTAGGGAA
-
SpeciesH. sapiens (human)
-
Entrez GeneTMEM217 (a.k.a. C6orf128, dJ355M6.2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer tggactatcatatgcttacc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX459-TMEM217-gRNA#1 was a gift from Masahito Ikawa (Addgene plasmid # 249417 ; http://n2t.net/addgene:249417 ; RRID:Addgene_249417) -
For your References section:
Formation of a complex between TMEM217 and the sodium-proton exchanger SLC9C1 is crucial for mouse sperm motility and male fertility. Iida-Norita R, Miyata H, Ninomiya A, Emori C, Kamoshita M, Pan C, Wang H, Ikawa M. Proc Natl Acad Sci U S A. 2025 Oct 21;122(42):e2513924122. doi: 10.1073/pnas.2513924122. Epub 2025 Oct 15. 10.1073/pnas.2513924122 PubMed 41091759