-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 24952 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLZRS
- Backbone size w/o insert (bp) 11100
-
Vector typeRetroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDNMT1
-
SpeciesH. sapiens (human)
-
Entrez GeneDNMT1 (a.k.a. ADCADN, AIM, CXXC9, DNMT, HSN1E, MCMT, m.HsaI)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer TGGATACACGCCGCCCACGTG
- 3′ sequencing primer ATCGTCGACCACTGTGCTGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byfull length WT DNMT1 cDNA from Open Biosystems
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LZRS-DNMT1 was a gift from Paul Khavari (Addgene plasmid # 24952 ; http://n2t.net/addgene:24952 ; RRID:Addgene_24952) -
For your References section:
DNMT1 maintains progenitor function in self-renewing somatic tissue. Sen GL, Reuter JA, Webster DE, Zhu L, Khavari PA. Nature. 2010 Jan 28. 463(7280):563-7. 10.1038/nature08683 PubMed 20081831