Skip to main content

pAAV-CMV-FLEX-SaCas9-U6-sgHtr2c (mouse/rat)
(Plasmid #249541)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 249541 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV
  • Total vector size (bp) 7728
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Htr2c
  • gRNA/shRNA sequence
    GGTGTGACCTCGAAGTAACAT
  • Species
    M. musculus (mouse), R. norvegicus (rat)
  • Entrez Gene
    Htr2c (a.k.a. 5-HT-1C, 5-HT-2C, 5-HT1C, 5-HT2C, 5-HT2cR, 5-HTR2C, 5HT1c, Htr1c, SR1)
  • Entrez Gene
    Htr2c (a.k.a. 5-HT2C, 5-HTR2C, 5HT-1C)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CMV-FLEX-SaCas9-U6-sgHtr2c (mouse/rat) was a gift from Larry Zweifel (Addgene plasmid # 249541 ; http://n2t.net/addgene:249541 ; RRID:Addgene_249541)