pAAV-CMV-FLEX-SaCas9-U6-sgHtr2a rat
(Plasmid
#249542)
-
PurposeCre-dependent editing of rat Htr2a with SaCas9
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249542 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
- Total vector size (bp) 7728
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHtr2a
-
gRNA/shRNA sequenceGGCCATCACCTAATTGCATTA
-
SpeciesR. norvegicus (rat)
-
Entrez GeneHtr2a (a.k.a. 5-HT2A, 5Ht-2)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CMV-FLEX-SaCas9-U6-sgHtr2a rat was a gift from Larry Zweifel (Addgene plasmid # 249542 ; http://n2t.net/addgene:249542 ; RRID:Addgene_249542)