pDEST14-His6-TEV-SpyCatcher003-cys
(Plasmid
#249543)
-
PurposeExpresses SpyCatcher003 with a N-terminal 6x-His tag and a C-terminal cysteine in E.coli under the T7 promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249543 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDEST14
- Backbone size w/o insert (bp) 3641
- Total vector size (bp) 4079
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSpyCatcher003-cys
-
Alt nameSC003-cys
-
Alt nameSC3-cys
-
Alt nameHis6-TEV-SC003-cys
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)438
- Promoter T7
-
Tags
/ Fusion Proteins
- 6x His (N terminal on insert)
- Cysteine (C terminal on insert)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMark Howarth (Addgene Plasmid # 133447)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.07.09.663943 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDEST14-His6-TEV-SpyCatcher003-cys was a gift from Kai Zinn (Addgene plasmid # 249543 ; http://n2t.net/addgene:249543 ; RRID:Addgene_249543) -
For your References section:
A multiplex extracellular interactome screening method employing high-avidity nanoparticles. Anaya MA, Wang ML, Gonzalez E, Lam AW, Vasnarungruengkul P, Vielmetter J, Wojtowicz WM, Zinn K. bioRxiv 2025.07.09.663943 10.1101/2025.07.09.663943