pDEST14-His6-TEV-SpyCatcher003-cys
(Plasmid #249543)

• Purpose: Expresses SpyCatcher003 with a N-terminal 6x-His tag and a C-terminal cysteine in E.coli under the T7 promoter
• Depositing Lab: Kai Zinn
• Publication: Anaya et al bioRxiv 2025.07.09.663943

Backbone

• Vector backbone: pDEST14
• Backbone size w/o insert (bp): 3641
• Total vector size (bp): 4079
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: SpyCatcher003-cys
• Alt name: SC003-cys
• Alt name: SC3-cys
• Alt name: His6-TEV-SC003-cys
• Species: Streptococcus pyogenes
• Insert Size (bp): 438
• Promoter: T7
• Tags / Fusion Proteins:
  • 6x His (N terminal on insert)
  • Cysteine (C terminal on insert)

Cloning Information

• Cloning method: Gene Synthesis
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Resource Information

• Supplemental Documents:
  • SF69XR_1_pDEST14-SC3cys.gbk
• A portion of this plasmid was derived from a plasmid made by: Mark Howarth (Addgene Plasmid # 133447)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2025.07.09.663943 for bioRxiv preprint.