pCX-FLAG-KAT2B
(Plasmid
#249547)
-
PurposeExpression of FLAG-KAT2B (a.k.a. P/CAF) in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249547 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCX
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 7000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKat2B
-
Alt namep300/CBP-associated factor (P/CAF)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2520
-
GenBank IDU57317
-
Entrez GeneKAT2B (a.k.a. CAF, P/CAF, PCAF)
- Promoter CAG
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCX-FLAG-KAT2B was a gift from Xiang-Jiao Yang (Addgene plasmid # 249547 ; http://n2t.net/addgene:249547 ; RRID:Addgene_249547) -
For your References section:
A p300/CBP-associated factor that competes with the adenoviral oncoprotein E1A. Yang XJ, Ogryzko VV, Nishikawa J, Howard BH, Nakatani Y. Nature. 1996 Jul 25. 382(6589):319-24. 10.1038/382319a0 PubMed 8684459