Skip to main content

pT7II-2N3Rtau
(Plasmid #249551)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 249551 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pT7II
  • Backbone manufacturer
    3256
  • Total vector size (bp) 4489
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    To produce tau protein, express in BL21(DE3) Codon Plus RP. Purify by Ni IMAC and SEC.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Tau (2N3R)
  • Alt name
    NM_001203252.2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1233
  • Entrez Gene
    MAPT (a.k.a. DDPAC, FTD1, FTDP-17, MAPTL, MSTD, MTBT1, MTBT2, PPND, PPP1R103, TAU, Tau-PHF6, tau-40)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Ndel (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GATTATCAACCGGGGTGGCA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT7II-2N3Rtau was a gift from Jeff Kuret (Addgene plasmid # 249551 ; http://n2t.net/addgene:249551 ; RRID:Addgene_249551)
  • For your References section:

    Efficient tag-less purification of recombinant human tau proteins. Pettis JA, Orshoski M, Pal S, Allen AM, Ortega Zepeda M, Wysocki VH, Kuret J. Anal Biochem. 2026 Mar 4;714:116095. doi: 10.1016/j.ab.2026.116095. 10.1016/j.ab.2026.116095 PubMed 41791447