pT7II-1N3Rtau
(Plasmid
#249552)
-
PurposeRecombinant protein synthesis of 1N3R isoform of human Tau
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249552 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepT7II
- Backbone size w/o insert (bp) 3256
- Total vector size (bp) 4402
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsTo produce tau protein, express in BL21(DE3) Codon Plus RP. Purify by Ni IMAC and SEC.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTau (1N3R)
-
Alt nameNM_001203251.1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1146
-
Entrez GeneMAPT (a.k.a. DDPAC, FTD1, FTDP-17, MAPTL, MSTD, MTBT1, MTBT2, PPND, PPP1R103, TAU, Tau-PHF6, tau-40)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Ndel (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GATTATCAACCGGGGTGGCA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7II-1N3Rtau was a gift from Jeff Kuret (Addgene plasmid # 249552 ; http://n2t.net/addgene:249552 ; RRID:Addgene_249552) -
For your References section:
Efficient tag-less purification of recombinant human tau proteins. Pettis JA, Orshoski M, Pal S, Allen AM, Ortega Zepeda M, Wysocki VH, Kuret J. Anal Biochem. 2026 Mar 4;714:116095. doi: 10.1016/j.ab.2026.116095. 10.1016/j.ab.2026.116095 PubMed 41791447