pT7II-0N3Rtau
(Plasmid #249553)

• Purpose: Recombinant protein synthesis of 0N3R isoform of human Tau
• Depositing Lab: Jeff Kuret
• Publication: Efficient Tag-less Purification of Human Tau Proteins (unpublished)

Backbone

• Vector backbone: pT7II
• Backbone size w/o insert (bp): 3256
• Total vector size (bp): 4315
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Tau (0N3R)
• Alt name: NM_016841.5
• Species: H. sapiens (human)
• Insert Size (bp): 1059
• Entrez Gene: MAPT (a.k.a. DDPAC, FTD1, FTDP-17, MAPTL, MSTD, MTBT1, MTBT2, PPND, PPP1R103, TAU, Tau-PHF6, tau-40)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Ndel (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GATTATCAACCGGGGTGGCA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry