pCAG-MitoRlucN-T2A-RlucCER-IRES-mCherry
(Plasmid
#249563)
-
PurposeFor detection of ER-mitochondrial contact
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249563 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG-IRES-mCherry
- Backbone size w/o insert (bp) 6108
- Total vector size (bp) 7439
-
Vector typeMammalian Expression, Luciferase, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMitoRlucN-T2A-RlucCER
-
SpeciesSynthetic
-
Insert Size (bp)1320
- Promoter Chicken beta-actin promoter with CMV enhancer
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgctgtctcatcattttggcaaagcaccATGGCCATCCAGCTGCGGTC
- 3′ sequencing primer cccctagaagcttctgcagatcatttcatgaacaagccaacgaaca
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-MitoRlucN-T2A-RlucCER-IRES-mCherry was a gift from Ginam Cho & Jeffrey Golden & Youngshin Lim (Addgene plasmid # 249563 ; http://n2t.net/addgene:249563 ; RRID:Addgene_249563) -
For your References section:
Split-Luciferase Reassembly Assay to Measure Endoplasmic Reticulum-Mitochondria Contacts in Live Cells. Chen C, Rafael KA, Cho G, Lim Y. J Vis Exp. 2024 Oct 11;(212):10.3791/66862. doi: 10.3791/66862. 10.3791/66862 PubMed 39465944