pX458_GAPDH-sgRNA
(Plasmid
#249575)
-
PurposeExpresses SpCas9, GFP, and sgRNA targeting GAPDH.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249575 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepx458
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGAPDH-sgRNA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
- Promoter U6 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bbsl (destroyed during cloning)
- 3′ cloning site Bbsl (destroyed during cloning)
- 5′ sequencing primer ATGGACTATCATATGCTTACCGTA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX458_GAPDH-sgRNA was a gift from Joe Zhang (Addgene plasmid # 249575 ; http://n2t.net/addgene:249575 ; RRID:Addgene_249575) -
For your References section:
Protocol for high-efficiency generation of iPSCs stably expressing Cas9-EGFP using the selection by essential gene exon knockin method. Zhang Y, Yang H, Yang Y, Lu Z, Cheng L, Tan H, Zhang JZ. STAR Protoc. 2025 Jul 4;6(3):103928. doi: 10.1016/j.xpro.2025.103928. 10.1016/j.xpro.2025.103928 PubMed 40618370