Skip to main content
Addgene
Open Menu

P1834: Eva3_RHISA-P1142_AMBCA-P991_AMCA-StrepII-8xHis
(Plasmid #249612)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 249612 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pHLsec
  • Backbone size w/o insert (bp) 4503
  • Total vector size (bp) 5472
  • Vector type
    Mammalian Expression ; mammalian expression vector, with Ampicillin resistance for maintaining and amplifying the plasmid in bacteria

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EVA3_RHISA:E1142_AMBCJ:EV991_AMBCJ (Genetic fusion of Evasin proteins EVA3, E1142 and EV991 with G4S linkers)
  • Species
    Rhipicephalus sanguineus (tick) and Amblyomma cajennense (tick)
  • Insert Size (bp)
    969
  • Promoter CMV enhancer-chicken beta-actin promoter
  • Tag / Fusion Protein
    • Strep II, 8xHis (C terminal on insert)

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer CTTCTTCTTTTTCCTACAGCTCCTG
  • 3′ sequencing primer CCTTCTGATAGGCAGCCTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The P1834 plasmid was cloned in the lab using used splicing-by-overlap-PCR to introduce the inserts coding for EV991, E1142 and EVA3 and using the plasmid backbone is pHLsec (Aricescu et al., 2006; doi: https://doi.org/10.1107/S0907444906029799)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    P1834: Eva3_RHISA-P1142_AMBCA-P991_AMCA-StrepII-8xHis was a gift from Shoumo Bhattacharya (Addgene plasmid # 249612 ; http://n2t.net/addgene:249612 ; RRID:Addgene_249612)
Related items: