pCAG-GCaMP6f
(Plasmid
#249680)
-
PurposeExpresses GCaMP6f under the CAG promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249680 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAGGS
- Backbone size w/o insert (bp) 4792
- Total vector size (bp) 6145
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGCaMP6f
-
SpeciesSynthetic
-
Insert Size (bp)1353
- Promoter CAG
Cloning Information
- Cloning method Other
- 5′ sequencing primer CTGCTAACCATGTTCATGCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.09.13.612584 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-GCaMP6f was a gift from Takeshi Imai (Addgene plasmid # 249680 ; http://n2t.net/addgene:249680 ; RRID:Addgene_249680) -
For your References section:
Isotonic and minimally invasive optical clearing media for live cell imaging ex vivo and in vivo. Inagaki S, Nakagawa-Tamagawa N, Huynh NZ, Kambe Y, Yagasaki R, Manita S, Fujimoto S, Noda T, Mori M, Teranishi A, Takeshima H, Ishikawa K, Naitou Y, Yokoyama T, Sakamoto M, Hayashi K, Kitamura K, Tagawa Y, Okuda S, Sato TK, Imai T. Nat Methods. 2026 Mar 12. doi: 10.1038/s41592-026-03023-y. 10.1038/s41592-026-03023-y PubMed 41820664