pCMV6-TOP3B (R338W)-3xFLAG
(Plasmid
#249683)
-
PurposeExpresses human TOP3B (R338W; "self-trapping" mutant) with a C-terminal 3xFLAG tag in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249683 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV6
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman TOP3B
-
SpeciesH. sapiens (human)
-
Entrez GeneTOP3B (a.k.a. TOP3B1)
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xFLAG (C terminal on insert)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV6-TOP3B (R338W)-3xFLAG was a gift from Michael Kearse (Addgene plasmid # 249683 ; http://n2t.net/addgene:249683 ; RRID:Addgene_249683) -
For your References section:
An autism spectrum disorder mutation in Topoisomerase 3beta causes accumulation of covalent mRNA intermediates by disrupting metal binding within the zinc finger domain. Warrick JE, Attili D, van Eeuwen T, Pastore B, Hoffmann-Weitsman SE, Forsyth NC, Tang W, Barmada SJ, Kearse MG. Nucleic Acids Res. 2025 Oct 28;53(20):gkaf1138. doi: 10.1093/nar/gkaf1138. 10.1093/nar/gkaf1138 PubMed 41189056