pPig-hEF1a-Cry2PHR-LRP6c-Puro-Blind
(Plasmid #249712)

• Purpose: Expresses optogenetic LRP6 in mammalian cells; no fluorescent proteins. Plasmid contains a puromycin selection marker.
• Depositing Lab: Max Wilson
• Publication: Rosen et al bioRxiv [Preprint]. 2025 May 23:2025.02.04.636331. doi: 10.1101/2025.02.04.636331.

Backbone

• Vector backbone: piggyBac
• Backbone size w/o insert (bp): 3211
• Total vector size (bp): 7634
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Cry2-LRP6
• Species: H. sapiens (human), A. thaliana (mustard weed)
• Insert Size (bp): 1518
• Entrez Gene: CRY2 (a.k.a. AT1G04400, AT-PHH1, ATCRY2, CRYPTOCHROME 2 APOPROTEIN, F19P19.14, F19P19_14, FHA, PHH1, cryptochrome 2)
• Entrez Gene: LRP6 (a.k.a. ADCAD2, EVR8, STHAG7)
• Promoter: hEF1a

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: atctgctttttgcttgtactgtcgaccctgtggaatg

Gene/Insert 2

• Gene/Insert name: P2A-PuroR
• Insert Size (bp): 619
• Promoter: hEF1a

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: atctgctttttgcttgtactgtcgaccctgtggaatg

Resource Information

• Supplemental Documents:
  • ppig-hef1a-cry2phr-lrp6c-CaaX_puro.gbk
• A portion of this plasmid was derived from a plasmid made by: Dr. Ryan Lach

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2025.02.04.636331 for bioRxiv preprint.

The depositor confirms that discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences. Addgene NGS finds 31 amino acids deleted between LRP6 and T2A compared to the depositor reference sequence.