pPig-hEF1a-Cry2PHR-LRP6c-Puro-Blind
(Plasmid
#249712)
-
PurposeExpresses optogenetic LRP6 in mammalian cells; no fluorescent proteins. Plasmid contains a puromycin selection marker.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249712 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepiggyBac
- Backbone size w/o insert (bp) 3211
- Total vector size (bp) 7634
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer atctgctttttgcttgtactgtcgaccctgtggaatg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameP2A-PuroR
-
Insert Size (bp)619
- Promoter hEF1a
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer atctgctttttgcttgtactgtcgaccctgtggaatg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Ryan Lach
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.02.04.636331 for bioRxiv preprint.
The depositor confirms that discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences. Addgene NGS finds 31 amino acids deleted between LRP6 and T2A compared to the depositor reference sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPig-hEF1a-Cry2PHR-LRP6c-Puro-Blind was a gift from Max Wilson (Addgene plasmid # 249712 ; http://n2t.net/addgene:249712 ; RRID:Addgene_249712) -
For your References section:
Anti-resonance in developmental signaling regulates cell fate decisions. Rosen SJ, Witteveen O, Baxter N, Lach RS, Hopkins E, Bauer M, Wilson MZ. bioRxiv [Preprint]. 2025 May 23:2025.02.04.636331. doi: 10.1101/2025.02.04.636331. 10.1101/2025.02.04.636331 PubMed 39990305