pPig_8X-TOPFLash-tdIRFP_Puro
(Plasmid #249713)

• Purpose: TopFlash reporter with puromycin. Used as a live readout of downstream Wnt gene transcription.
• Depositing Lab: Max Wilson
• Publication: Rosen et al bioRxiv [Preprint]. 2025 May 23:2025.02.04.636331. doi: 10.1101/2025.02.04.636331.

Backbone

• Vector backbone: piggyBac
• Backbone size w/o insert (bp): 2818
• Total vector size (bp): 6133
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: tdiRFP
• Alt name: tandem dimer of iRFP713
• Species: H. sapiens (human)
• Insert Size (bp): 111
• Promoter: TopFlash, with 7x TCF/LEF motif

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gtaccgagctcttacgcgagat

Gene/Insert 2

• Gene/Insert name: T2A-PuroR
• Insert Size (bp): 600
• Promoter: TopFlash

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AAAACCCGGGTCCAatgacc

Resource Information

• Supplemental Documents:
  • ppig_8x_topflash-tdirfp_puro.gb
• A portion of this plasmid was derived from a plasmid made by: Dr. Ryan Lach

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2025.02.04.636331 for bioRxiv preprint.

The depositor confirms that discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences. Addgene NGS finds a 31 bp deletion in 7x TCF/LEF, and R123Q in tdIRFP (Twist 1) compared to the depositor reference sequence.