Skip to main content
Addgene
Open Menu

pLV-8xGTIIC-mScarlet-NLS-PEST
(Plasmid #249724)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 249724 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pLV
  • Backbone size w/o insert (bp) 6500
  • Total vector size (bp) 7700
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    YAP-TEAD responsive promoter
  • Alt name
    8xGTIIC
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1187
  • Entrez Gene
    YAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)
  • Tag / Fusion Protein
    • mScarlet3-NLS-PEST (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer cattccacacattccactgca
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The 8x-GTIIC promoter was cloned from the pTRE-8XGTIIC-DsRED-DD plasmid from the lab of Joan Massague (Addgene plasmid # 115798) into a backbone containing the NLS-PEST sequence from Yumi Konagaya and Tobias Meyer (Addgene plasmid # 212665).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.10.11.617852 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-8xGTIIC-mScarlet-NLS-PEST was a gift from Tobias Meyer (Addgene plasmid # 249724 ; http://n2t.net/addgene:249724 ; RRID:Addgene_249724)

  • For your References section:

    Transient proliferation by reversible YAP and mitogen-control of the cyclin D1/p27 ratio. Ferrick KR, Fan Y, Ratnayeke N, Teruel MN, Meyer T. bioRxiv [Preprint]. 2024 Nov 4:2024.10.11.617852. doi: 10.1101/2024.10.11.617852. 10.1101/2024.10.11.617852 PubMed 39416132
Related items: