Skip to main content

pCW-myc-YAP5SA-puro
(Plasmid #249725)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 249725 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCW57.1
  • Backbone size w/o insert (bp) 7612
  • Total vector size (bp) 9124
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    YAP5SA
  • Alt name
    YAP
  • Alt name
    YAP1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1512
  • Mutation
    S61A, S109A, S127A, S164A, S381A (phosphorylation sites, also S128A, S131A, S163A present as reported by Zhao et al.)
  • Entrez Gene
    YAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)
  • Promoter Tet ON
  • Tag / Fusion Protein
    • Myc (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer cagagctcgtttagtgaaccg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Myc-tagged YAP5SA was cloned from the Kunliang Guan lab (Addgene plasmid # 33093) and the digested backbone derived from Eric Lander and David Sabatini (Addgene plasmid # 50661).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.10.11.617852 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW-myc-YAP5SA-puro was a gift from Tobias Meyer (Addgene plasmid # 249725 ; http://n2t.net/addgene:249725 ; RRID:Addgene_249725)
  • For your References section:

    Transient proliferation by reversible YAP and mitogen-control of the cyclin D1/p27 ratio. Ferrick KR, Fan Y, Ratnayeke N, Teruel MN, Meyer T. bioRxiv [Preprint]. 2024 Nov 4:2024.10.11.617852. doi: 10.1101/2024.10.11.617852. 10.1101/2024.10.11.617852 PubMed 39416132