pCW-myc-YAP5SA-puro
(Plasmid
#249725)
-
PurposeDoxycycline-inducible expression of myc epitope-tagged YAP5SA with puro selection
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249725 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCW57.1
- Backbone size w/o insert (bp) 7612
- Total vector size (bp) 9124
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameYAP5SA
-
Alt nameYAP
-
Alt nameYAP1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1512
-
MutationS61A, S109A, S127A, S164A, S381A (phosphorylation sites, also S128A, S131A, S163A present as reported by Zhao et al.)
-
Entrez GeneYAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)
- Promoter Tet ON
-
Tag
/ Fusion Protein
- Myc (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer cagagctcgtttagtgaaccg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMyc-tagged YAP5SA was cloned from the Kunliang Guan lab (Addgene plasmid # 33093) and the digested backbone derived from Eric Lander and David Sabatini (Addgene plasmid # 50661).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.10.11.617852 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW-myc-YAP5SA-puro was a gift from Tobias Meyer (Addgene plasmid # 249725 ; http://n2t.net/addgene:249725 ; RRID:Addgene_249725) -
For your References section:
Transient proliferation by reversible YAP and mitogen-control of the cyclin D1/p27 ratio. Ferrick KR, Fan Y, Ratnayeke N, Teruel MN, Meyer T. bioRxiv [Preprint]. 2024 Nov 4:2024.10.11.617852. doi: 10.1101/2024.10.11.617852. 10.1101/2024.10.11.617852 PubMed 39416132