pCS2 xWnt11
(Plasmid
#24973)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 24973 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCS2
- Backbone size w/o insert (bp) 4100
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameWnt11
-
SpeciesX. laevis (frog)
-
Entrez Genewnt11 (a.k.a. Wnt11r, Xwnt-11, Xwnt11, wnt11-r)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer SP6
- 3′ sequencing primer T7
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For sense mRNA cut with NotI, transcribe with SP6
Sense: 5'AAAGAATTCCTTACCCCTCACCAGATACCT
Antisense:
5'TTTCTCGAGTTACTTGAGACATACCT
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2 xWnt11 was a gift from Edward De Robertis (Addgene plasmid # 24973 ; http://n2t.net/addgene:24973 ; RRID:Addgene_24973)
Map uploaded by the depositor.