PiggyBac CAG eGFP-PolQ-FLAG P2A-BLAST
(Plasmid
#249811)
-
PurposeExpresses the PolQ (polymerase theta) protein fused with N-terminal eGFP and C-terminal FLAG tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249811 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePiggyBac CAG eGFP
-
Backbone manufacturerJoseph Loturco (Addgene #40973)
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 14514
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePolymerase Theta
-
Alt namePOLQ
-
SpeciesH. sapiens (human)
-
Insert Size (bp)9000
-
Entrez GenePOLQ (a.k.a. PRO0327)
- Promoter CAG
-
Tags
/ Fusion Proteins
- eGFP (N terminal on insert)
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsrGI (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer tggcaaagaattctgcagtc
- 3′ sequencing primer cagccagcatatggcatatg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byJ. Stewart-Ornstein (P2A-BLAST cassette)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
"Exogenous expression of all Polθ constructs (GFP–Polθ) used in this study was achieved by cloning full-length POLQ fused with a C-terminal Flag-P2A-BLAST cassette in the PiggyBac CAG eGFP vector (Addgene, #40973) between BsrGI and SacI restriction sites. The P2A-BLAST cassette was amplified from the eFlut P2A-BLAST plasmid (gift from J. Stewart-Ornstein) with forward primer containing the Flag sequence." (Gelot et al., Nature 2023)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PiggyBac CAG eGFP-PolQ-FLAG P2A-BLAST was a gift from Raphael Ceccaldi (Addgene plasmid # 249811 ; http://n2t.net/addgene:249811 ; RRID:Addgene_249811) -
For your References section:
Poltheta is phosphorylated by PLK1 to repair double-strand breaks in mitosis. Gelot C, Kovacs MT, Miron S, Mylne E, Haan A, Boeffard-Dosierre L, Ghouil R, Popova T, Dingli F, Loew D, Guirouilh-Barbat J, Del Nery E, Zinn-Justin S, Ceccaldi R. Nature. 2023 Sep;621(7978):415-422. doi: 10.1038/s41586-023-06506-6. Epub 2023 Sep 6. 10.1038/s41586-023-06506-6 PubMed 37674080