PiggyBac CAG eGFP-PolQ10A-FLAG P2A-BLAST
(Plasmid #249812)

• Purpose: Expresses the polymerase theta protein fused with N-terminal eGFP and C-terminal FLAG tag and mutated at serines 1289, 1482, 1486, 1488, 1493, 1555, 1563, 1628, 1635 and threonine 1755 into alanines
• Depositing Lab: Raphael Ceccaldi
• Publication: Gelot et al Nature. 2023 Sep;621(7978):415-422. doi: 10.1038/s41586-023-06506-6. Epub 2023 Sep 6.

Backbone

• Vector backbone: PiggyBac CAG eGFP
• Backbone manufacturer: Joseph Loturco (Addgene #40973)
• Backbone size w/o insert (bp): 5500
• Total vector size (bp): 14514
• Vector type: Mammalian Expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Polymerase Theta
• Alt name: POLQ
• Species: H. sapiens (human)
• Insert Size (bp): 9000
• Mutation: serines 1289, 1482, 1486, 1488, 1493, 1555, 1563, 1628, 1635 and threonine 1755 into alanines
• Entrez Gene: POLQ (a.k.a. PRO0327)
• Promoter: CAG
• Tags / Fusion Proteins:
  • eGFP (N terminal on insert)
  • FLAG (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: tggcaaagaattctgcagtc
• 3′ sequencing primer: cagccagcatatggcatatg

Resource Information

• Supplemental Documents:
  • pbcag-egfp-polq-10a2-flag-p2a-blast.gb
• A portion of this plasmid was derived from a plasmid made by: J. Stewart-Ornstein (P2A-BLAST cassette)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

"Exogenous expression of all Polθ constructs (GFP–Polθ) used in this study was achieved by cloning full-length POLQ fused with a C-terminal Flag-P2A-BLAST cassette in the PiggyBac CAG eGFP vector (Addgene, #40973) between BsrGI and SacI restriction sites. The P2A-BLAST cassette was amplified from the eFlut P2A-BLAST plasmid (gift from J. Stewart-Ornstein) with forward primer containing the Flag sequence."
"Polθ(10A) and Polθ(4A) were obtained by amplification of DNA fragments with the desired mutations (gBlocks from Integrated DNA Technologies) cloned into PiggyBac CAG eGFP-POLQ-Flag-P2A-BLAST between PflFI and NheI restriction sites." (Gelot et al., Nature, 2023)