pAAV Syn-V5-TurboID-CAAX_v1
(Plasmid
#250175)
-
PurposeMembrane-TurboID variant for neuron expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250175 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAV
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTurboID
-
SpeciesSynthetic
- Promoter hSyn
-
Tags
/ Fusion Proteins
- V5 (N terminal on insert)
- CAAX (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer actcagcgctgcctcagtctgc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV Syn-V5-TurboID-CAAX_v1 was a gift from Christina Kim (Addgene plasmid # 250175 ; http://n2t.net/addgene:250175 ; RRID:Addgene_250175)