pCMV-SNAPtag-PixE
(Plasmid
#250232)
-
PurposeRELISR, basic form, monomer conjugated PixE
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250232 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepmCherry-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3968
- Total vector size (bp) 5741
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePixE
-
Alt nameSlr1693
-
SpeciesSynthetic
-
Entrez Geneslr1693 (a.k.a. SYNGTS_1813)
- Promoter CMV
-
Tag
/ Fusion Protein
- SNAPtag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGGAGGGGGAGGCTccggaatgagcaattcagttttg
- 3′ sequencing primer GTTATCTAGATCCGGTGGATCctcaggagttggttttattg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Additional sequencing primer may be needed: gcattaatgctacagcccat
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-SNAPtag-PixE was a gift from Won Do Heo (Addgene plasmid # 250232 ; http://n2t.net/addgene:250232 ; RRID:Addgene_250232) -
For your References section:
Optogenetic storage and release of protein and mRNA in live cells and animals. Lee C, Yu J, Shin J, Yu J, Heo Y, Lee M, Yu D, Park Y, Heo WD. Nat Commun. 2025 Jul 7;16(1):6230. doi: 10.1038/s41467-025-61322-y. 10.1038/s41467-025-61322-y PubMed 40624072