AAV-CaMKIIα-optoFGFR1-HA
(Plasmid
#250236)
-
PurposeAAV expressing light-activatable FGFR1 (optoFGFR1-HA) under the CaMKIIα promoter for excitatory-neuron-specific activation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250236 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV-CamKIIα
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFGFR1
-
SpeciesH. sapiens (human)
-
Entrez GeneFGFR1 (a.k.a. BFGFR, CD331, CEK, ECCL, FGFBR, FGFR-1, FLG, FLT-2, FLT2, HBGFR, HH2, HRTFDS, KAL2, N-SAM, OGD, bFGF-R-1)
- Promoter CamKIIα
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer aacttgtggactaagtttgtt
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-CaMKIIα-optoFGFR1-HA was a gift from Won Do Heo (Addgene plasmid # 250236 ; http://n2t.net/addgene:250236 ; RRID:Addgene_250236) -
For your References section:
Dysregulation of FGFR1 signaling in the hippocampus facilitates depressive disorder. Shin J, Oh H, Park JH, Bae H, Yang CM, Lee M, Kim S, Heo WD. Exp Mol Med. 2025 Aug;57(8):1818-1836. doi: 10.1038/s12276-025-01519-9. Epub 2025 Aug 15. 10.1038/s12276-025-01519-9 PubMed 40813470