AAV-EF1α-DIO-DSE-mCherry-PSE-shRNA-Numb
(Plasmid
#250238)
-
PurposeCre-dependent AAV expressing mCherry and an shRNA targeting Numb under EF1α promoter for selective Numb knockdown
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250238 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV-EF1α-DIO-DSE-mCherry-PSE
-
Backbone manufacturerHeo Lab (KAIST)
- Total vector size (bp) 6794
-
Vector typeMammalian Expression, Mouse Targeting, AAV, RNAi, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNumb
-
Alt nameshRNA Numb
-
gRNA/shRNA sequenceCGCGGTTTCCTAGGTCTGTGA
-
SpeciesM. musculus (mouse)
-
Entrez GeneNumb (a.k.a. Nb)
- Promoter EF1α
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AvrII (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer TCTGTGAAGATGCCGTAAA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-EF1α-DIO-DSE-mCherry-PSE-shRNA-Numb was a gift from Won Do Heo (Addgene plasmid # 250238 ; http://n2t.net/addgene:250238 ; RRID:Addgene_250238) -
For your References section:
Dysregulation of FGFR1 signaling in the hippocampus facilitates depressive disorder. Shin J, Oh H, Park JH, Bae H, Yang CM, Lee M, Kim S, Heo WD. Exp Mol Med. 2025 Aug;57(8):1818-1836. doi: 10.1038/s12276-025-01519-9. Epub 2025 Aug 15. 10.1038/s12276-025-01519-9 PubMed 40813470