Skip to main content
Addgene
Open Menu

AAV-EF1α-DIO-DSE-mCherry-PSE-shRNA-Numb
(Plasmid #250238)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 250238 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pAAV-EF1α-DIO-DSE-mCherry-PSE
  • Backbone manufacturer
    Heo Lab (KAIST)
  • Total vector size (bp) 6794
  • Vector type
    Mammalian Expression, Mouse Targeting, AAV, RNAi, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Numb
  • Alt name
    shRNA Numb
  • gRNA/shRNA sequence
    CGCGGTTTCCTAGGTCTGTGA
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Numb (a.k.a. Nb)
  • Promoter EF1α

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AvrII (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer TCTGTGAAGATGCCGTAAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-EF1α-DIO-DSE-mCherry-PSE-shRNA-Numb was a gift from Won Do Heo (Addgene plasmid # 250238 ; http://n2t.net/addgene:250238 ; RRID:Addgene_250238)

  • For your References section:

    Dysregulation of FGFR1 signaling in the hippocampus facilitates depressive disorder. Shin J, Oh H, Park JH, Bae H, Yang CM, Lee M, Kim S, Heo WD. Exp Mol Med. 2025 Aug;57(8):1818-1836. doi: 10.1038/s12276-025-01519-9. Epub 2025 Aug 15. 10.1038/s12276-025-01519-9 PubMed 40813470
Related items: