pINEAPLE
(Plasmid
#250295)
-
PurposeBig-IN Payload assembly vector by Golden Gate Cloning using Esp3I. Contains a bacterial green/white GFP-based screening system and a mammalian transient (backbone) BSD selection cassette.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250295 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCustom
-
Backbone manufacturerMaurano lab, The Center for Synthetic Regulatory Genomics, NYU Langone Health
- Backbone size w/o insert (bp) 4858
- Total vector size (bp) 5916
-
Vector typeSynthetic Biology ; assembly vector for Big-IN payloads
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGrows as green/white colonies
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSuperfolderGFP
-
Insert Size (bp)1058
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer AGAATAGCAGGCATGCTGGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.08.13.669251 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pINEAPLE was a gift from Matthew Maurano (Addgene plasmid # 250295 ; http://n2t.net/addgene:250295 ; RRID:Addgene_250295) -
For your References section:
Synthetic genomic dissection of enhancer context sensitivity and synergy. Ordoñez R, Ribeiro-dos-Santos AM, McLoughlin C, Ellis G, Ashe HJ, Berastegui Zufiaurre N, Brosh R, Majewski M, Camellato B, Boeke JD, Maurano MT. bioRxiv 2025.08.13.669251 10.1101/2025.08.13.669251