Skip to main content

LentiGuideFUT5-neo
(Plasmid #250305)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 250305 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    LentiGuide-Neo
  • Backbone manufacturer
    Addgene 139449
  • Backbone size w/o insert (bp) 10378
  • Total vector size (bp) 8517
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FUT5 gRNA
  • gRNA/shRNA sequence
    ggagattgaagtatccgtcc
  • Species
    H. sapiens (human)
  • Entrez Gene
    FUT5 (a.k.a. FUC-TV)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer U6
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiGuideFUT5-neo was a gift from Jennifer Kohler (Addgene plasmid # 250305 ; http://n2t.net/addgene:250305 ; RRID:Addgene_250305)
  • For your References section:

    Hypofucosylation promotes pertussis toxin binding to cell surface glycococonjugates and pertussis toxin-induced intracellular ERK signaling. Konada RSR, Nischan N, Silva A, Kohler JJ. Glycobiology. 2026 Feb 26:cwag011. doi: 10.1093/glycob/cwag011. 10.1093/glycob/cwag011 PubMed 41744063