Skip to main content
Addgene
Open Menu

LentiGuideFUT8-neo
(Plasmid #250316)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 250316 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    LentiGuide-Neo
  • Backbone manufacturer
    Addgene 139449
  • Backbone size w/o insert (bp) 10378
  • Total vector size (bp) 8517
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FUT8 gRNA
  • gRNA/shRNA sequence
    gtcgtacaagtcgatctgcg
  • Species
    H. sapiens (human)
  • Entrez Gene
    FUT8 (a.k.a. CDGF, CDGF1)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer U6 promoter
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiGuideFUT8-neo was a gift from Jennifer Kohler (Addgene plasmid # 250316 ; http://n2t.net/addgene:250316 ; RRID:Addgene_250316)

  • For your References section:

    Hypofucosylation promotes pertussis toxin binding to cell surface glycococonjugates and pertussis toxin-induced intracellular ERK signaling. Konada RSR, Nischan N, Silva A, Kohler JJ. Glycobiology. 2026 Feb 26:cwag011. doi: 10.1093/glycob/cwag011. 10.1093/glycob/cwag011 PubMed 41744063
Related items: