pIND21-puro_SOX10-OLIG2-NKX6.2-3xFLAG
(Plasmid
#250320)
-
PurposeTetracycline-inducible expression of SOX10-OLIG2-NKX6.2 as polyprotein linked by self cleavage sites P2A and T2A. rtTA (Tet-ON) is driven the EF1alpha promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250320 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepIND21-puro
- Backbone size w/o insert (bp) 10400
- Total vector size (bp) 13809
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSOX10-P2A-OLIG2-T2A-NKX6.2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3400
-
Entrez GeneSOX10 (a.k.a. DOM, PCWH, SOX-10, WS2E, WS4, WS4C)
-
Entrez GeneOLIG2 (a.k.a. BHLHB1, OLIGO2, PRKCBP2, RACK17, bHLHe19)
-
Entrez GeneNKX6-2 (a.k.a. GTX, NKX6.2, NKX6B, SPAX8)
- Promoter TRE2
-
Tag
/ Fusion Protein
- 3xFLAG (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCGCCTGGAGACGCCATCC
- 3′ sequencing primer AGATCTTGGGTGGGTTACTCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The HA tag is not expressed.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIND21-puro_SOX10-OLIG2-NKX6.2-3xFLAG was a gift from Michael Wehr (Addgene plasmid # 250320 ; http://n2t.net/addgene:250320 ; RRID:Addgene_250320) -
For your References section:
Expression of Lineage Transcription Factors Identifies Differences in Transition States of Induced Human Oligodendrocyte Differentiation. Raabe FJ, Stephan M, Waldeck JB, Huber V, Demetriou D, Kannaiyan N, Galinski S, Glaser LV, Wehr MC, Ziller MJ, Schmitt A, Falkai P, Rossner MJ. Cells. 2022 Jan 11;11(2):241. doi: 10.3390/cells11020241. 10.3390/cells11020241 PubMed 35053357