Skip to main content

pIND21-puro_SOX10-3xFLAG
(Plasmid #250322)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 250322 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    p
  • Backbone size w/o insert (bp) 10400
  • Total vector size (bp) 11880
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SOX10
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1400
  • Entrez Gene
    SOX10 (a.k.a. DOM, PCWH, SOX-10, WS2E, WS4, WS4C)
  • Promoter TRE2
  • Tag / Fusion Protein
    • 3xFLAG (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCGCCTGGAGACGCCATCC
  • 3′ sequencing primer AGATCTTGGGTGGGTTACTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The HA tag is not expressed.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIND21-puro_SOX10-3xFLAG was a gift from Michael Wehr (Addgene plasmid # 250322 ; http://n2t.net/addgene:250322 ; RRID:Addgene_250322)
  • For your References section:

    Expression of Lineage Transcription Factors Identifies Differences in Transition States of Induced Human Oligodendrocyte Differentiation. Raabe FJ, Stephan M, Waldeck JB, Huber V, Demetriou D, Kannaiyan N, Galinski S, Glaser LV, Wehr MC, Ziller MJ, Schmitt A, Falkai P, Rossner MJ. Cells. 2022 Jan 11;11(2):241. doi: 10.3390/cells11020241. 10.3390/cells11020241 PubMed 35053357