pv6_MCPH1_BRCT W706RW815R
(Plasmid
#250355)
-
PurposeExpresses mutant tandem BRCT domain from MCPH1 fused to eGFP. Serves as control.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250355 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneparbit_v6
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMCPH1 tandem BRCT
-
SpeciesM. musculus (mouse)
-
MutationW706R and W815R
- Promoter CAGGS
-
Tags
/ Fusion Proteins
- biotintag, TEV cleavage (N terminal on insert)
- NLS, eGFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGAGGCCCAGAAGATCGAGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pv6_MCPH1_BRCT W706RW815R was a gift from Tuncay Baubec (Addgene plasmid # 250355 ; http://n2t.net/addgene:250355 ; RRID:Addgene_250355) -
For your References section:
Engineered chromatin readers track damaged chromatin dynamics in live cells and animals. da Silva RC, Eleftheriou K, Recchia DC, Portegijs V, Ten Bulte D, Kupfer N, Vroegindeweij-de Wagenaar NP, Vergara X, Ouchene A, van den Heuvel S, Baubec T. Nat Commun. 2025 Nov 20;16(1):10127. doi: 10.1038/s41467-025-65706-y. 10.1038/s41467-025-65706-y PubMed 41266351