pET21D_HspD1
(Plasmid
#250362)
-
PurposeExpresses HSPD1 / Hsp60 heat shock protein in E. coli
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250362 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET21D
- Backbone size w/o insert (bp) 5382
- Total vector size (bp) 7098
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name60 kDa heat shock protein, mitochondrial
-
Alt nameHsp60
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1716
-
GenBank ID3329
-
Entrez GeneHSPD1 (a.k.a. CPN60, GROEL, HLD4, HSP-60, HSP60, HSP65, HuCHA60, SPG13)
- Promoter T7
-
Tag
/ Fusion Protein
- 8xHis and TEV site (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer tgcaccaaattttacatctttggc
- 3′ sequencing primer gaacatgccacctcccataccacctc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byC. Weiss, PhD.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET21D_HspD1 was a gift from Abdussalam Azem (Addgene plasmid # 250362 ; http://n2t.net/addgene:250362 ; RRID:Addgene_250362)