Lenti-U6-sgRNA_NUDT5_ex4-EF1α-Cas9-NLS-FLAG-GSG-P2A-PuroR-WPRE
(Plasmid
#250374)
-
PurposeLentiviral expression of sgRNA against human NUDT5 exon 4 under U6 promoter and Cas9-NLS-FLAG-GSG-P2A-PuroR under EF1α core promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250374 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePX459
-
Backbone manufacturerFeng Zhang (Addgene #62988)
-
Vector typeLentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgNUDT5
-
gRNA/shRNA sequenceaatcagtgaaacgtacaacc
-
SpeciesH. sapiens (human)
-
Entrez GeneNUDT5 (a.k.a. YSA1, YSA1H, YSAH1, hNUDT5)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti-U6-sgRNA_NUDT5_ex4-EF1α-Cas9-NLS-FLAG-GSG-P2A-PuroR-WPRE was a gift from Stefan Kubicek (Addgene plasmid # 250374 ; http://n2t.net/addgene:250374 ; RRID:Addgene_250374) -
For your References section:
A non-enzymatic role of Nudix hydrolase 5 in repressing purine de novo synthesis. Nguyen TA, Lin JG, Marques AMC, Fottner M, Bauer LG, Reicher A, Daum D, Scrofani L, Liu Y, Cheng C, D'Angelo L D D L, Sanchez J, Bueschl C, Marella N, Buphamalai P, Traversi F, Beres M, Moll HP, Siklos M, Genger JW, Hofstaetter G, Villanti L, Malik M, Klimek C, Runggatscher K, Guertl B, Hansen JS, Dobner S, Babosova O, Becirovic T, de Rooij LPMH, Casanova E, Koren A, Froese DS, Rosenblatt DS, Klavins K, Bergthaler A, Menche J, Hannich JT, Abele M, Sdelci S, Lang K, Huber KVM, Kubicek S. Science. 2025 Nov 6:eadv4257. doi: 10.1126/science.adv4257. 10.1126/science.adv4257 PubMed 41196952