pLexM-HsPQLC1(Δ100-125/3xGGGS)-FLAG
(Plasmid
#250424)
-
PurposeExpression of C-terminally FLAG-Tagged HsPQLC1 (Δ100-125 - with these residues replaced by a 3xGGGS Linker) in Mammalian Cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250424 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLexM
-
Backbone manufacturerEdith Yvonne Jones (Addgene # 99844)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePQLC1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)771
-
MutationΔ100-125 (Replaced with 3xGGGS)
-
Entrez GeneSLC66A2 (a.k.a. PQLC1)
- Promoter Chicken-beta-actin promoter/CMV Enhancer
-
Tag
/ Fusion Protein
- FLAG (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer GCTGGTTGTTGTGCTGTCTCATC
- 3′ sequencing primer ATCACCATCTAATTCAACCAA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLexM-HsPQLC1(Δ100-125/3xGGGS)-FLAG was a gift from Simon Newstead (Addgene plasmid # 250424 ; http://n2t.net/addgene:250424 ; RRID:Addgene_250424)