pcDNA3.1(+)_GammaActin_ALFA_229230
(Plasmid
#250440)
-
PurposeExpresses tagged gamma cytoplasmic actin in mammalian cells. Protein is tagged with an internal ALFA tag at position T229/A230.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250440 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1(+)
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 6591
-
Modifications to backboneNA
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGamma Cytoplasmic Actin
-
Alt nameACTG1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1173
-
GenBank IDNM_001199954
-
Entrez GeneACTG1 (a.k.a. ACT, ACTG, DFNA20, DFNA26, HEL-176)
- Promoter CMV Promotor
-
Tag
/ Fusion Protein
- ALFA Tag (Internal)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGACGCAAATGGGCGGTAG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1(+)_GammaActin_ALFA_229230 was a gift from Koen van den Dries (Addgene plasmid # 250440 ; http://n2t.net/addgene:250440 ; RRID:Addgene_250440) -
For your References section:
IntAct: A nondisruptive internal tagging strategy to study the organization and function of actin isoforms. van Zwam MC, Dhar A, Bosman W, van Straaten W, Weijers S, Seta E, Joosten B, van Haren J, Palani S, van den Dries K. PLoS Biol. 2024 Mar 11;22(3):e3002551. doi: 10.1371/journal.pbio.3002551. eCollection 2024 Mar. 10.1371/journal.pbio.3002551 PubMed 38466773