pTE5601
(Plasmid
#250509)
-
PurposePurification of SUMO-dark; inhibitor of 11S; breakage control for translocation/insertion assays
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250509 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTB146
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameT7-SUMO-dark
-
SpeciesS. cerevisiae (budding yeast)
- Promoter T7
-
Tag
/ Fusion Protein
- dark peptide (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGCGTCCGGCGTAG
- 3′ sequencing primer TGCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.64898/2025.12.09.688994 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTE5601 was a gift from Tobias Erb (Addgene plasmid # 250509 ; http://n2t.net/addgene:250509 ; RRID:Addgene_250509) -
For your References section:
Functional Mapping and Engineering of the Sec Translocon Unlocked by a Cell-Free System. Meier M, Scholz SA, von Bank L, Levandoski JE, Lückhof M, Schaaf M, Si S, Lieberwirth I, Jung AL, Landfester K, Driessen AJM, Erb TJ. bioRxiv 2025.12.09.688994 10.64898/2025.12.09.688994