pTE5602
(Plasmid
#250510)
-
PurposeCell-free translocation reporter; proOmpA (1-178); C-terminal pep99 tag
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250510 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameT7-proOmpA-pep99
-
SpeciesE. coli
-
Entrez GeneompA (a.k.a. b0957, ECK0948, con, tolG, tut)
- Promoter T7
-
Tag
/ Fusion Protein
- pep99 (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGCGTCCGGCGTAG
- 3′ sequencing primer TGCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.64898/2025.12.09.688994 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTE5602 was a gift from Tobias Erb (Addgene plasmid # 250510 ; http://n2t.net/addgene:250510 ; RRID:Addgene_250510) -
For your References section:
Functional Mapping and Engineering of the Sec Translocon Unlocked by a Cell-Free System. Meier M, Scholz SA, von Bank L, Levandoski JE, Lückhof M, Schaaf M, Si S, Lieberwirth I, Jung AL, Landfester K, Driessen AJM, Erb TJ. bioRxiv 2025.12.09.688994 10.64898/2025.12.09.688994