Skip to main content

pTE5636
(Plasmid #250518)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 250518 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    T7-p(extCore)OAss-nanobody-HiBiT
  • Species
    Vicugna pacos
  • Promoter T7
  • Tag / Fusion Protein
    • pep86 (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGCGTCCGGCGTAG
  • 3′ sequencing primer TGCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dirk Görlich (nanobody sourced from Addgene #104161)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.64898/2025.12.09.688994 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTE5636 was a gift from Tobias Erb (Addgene plasmid # 250518 ; http://n2t.net/addgene:250518 ; RRID:Addgene_250518)
  • For your References section:

    Functional Mapping and Engineering of the Sec Translocon Unlocked by a Cell-Free System. Meier M, Scholz SA, von Bank L, Levandoski JE, Lückhof M, Schaaf M, Si S, Lieberwirth I, Jung AL, Landfester K, Driessen AJM, Erb TJ. bioRxiv 2025.12.09.688994 10.64898/2025.12.09.688994