pLVX-TetOn-puro-ICP4
(Plasmid
#250611)
-
PurposeMammalian lentiviral vector for the inducible (TetOn) expression of codon-optimized HSV-1 ICP4
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250611 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLVX-TetOn-puro
- Backbone size w/o insert (bp) 9180
- Total vector size (bp) 13079
-
Modifications to backboneInsertion of codon-optimized HSV-1 ICP4 at the MCS
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameICP4
-
Alt nameIE175
-
Alt namevmw175
-
Alt nameα4
-
SpeciesHerpes simplex virus 1 (KOS strain)
-
Insert Size (bp)3885
-
MutationCodon-optimized for Homo sapiens
- Promoter TRE3GS promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cttataccaactttccgtaccacttcctaccctcgtaaagaattcgcaggctcttaaggccacca
- 3′ sequencing primer tcattggctgtccagcttagctcGCAGGGGAGGTGGTCTGggagggagaggggcatcg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCloned codon-optimized ICP4 from Addgene #250609 (pTRE-ICP4-BFP-Neo)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.06.20.660750 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX-TetOn-puro-ICP4 was a gift from Liam Holt (Addgene plasmid # 250611 ; http://n2t.net/addgene:250611 ; RRID:Addgene_250611)