pVB240306
(Plasmid
#250660)
-
PurposeE. coli expression of the GSM domain of mouse ChREBPalpha (aa 43-207)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250660 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET
-
Backbone manufacturerVectorBuilder
- Backbone size w/o insert (bp) 5636
- Total vector size (bp) 6455
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameChREBP alpha GSM domain
-
Alt nameMetHis6mouseChREBPalpha43-307
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)819
-
Mutationcontains aa 43-307 only, with optimized E. coli codons
-
Entrez GeneMlxipl (a.k.a. ChREBP, Mlx, WS-bHLH, Wbscr14, bHLHd14)
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATGCATCATCACCATCACCAC CGATCACAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVB240306 was a gift from Charles Brenner (Addgene plasmid # 250660 ; http://n2t.net/addgene:250660 ; RRID:Addgene_250660) -
For your References section:
Glycerol-3-phosphate activates ChREBP, FGF21 transcription and lipogenesis in citrin deficiency. Tiwari V, Jin B, Sun O, Lopez Gonzalez EDJ, Chen MH, Wu X, Shah H, Zhang A, Herman MA, Spracklen CN, Goodman RP, Brenner C. Nat Metab. 2025 Nov;7(11):2284-2299. doi: 10.1038/s42255-025-01399-3. Epub 2025 Nov 14. 10.1038/s42255-025-01399-3 PubMed 41238906