Skip to main content

pAAV-UbC-CytoTape-vivo-HA
(Plasmid #250670)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 250670 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV-UbC
  • Backbone manufacturer
    Epoch Life Science, Inc.
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CytoTape-vivo-HA
  • Species
    Synthetic
  • Promoter UbC promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTGCGCAGATCGATAACTAGTGC
  • 3′ sequencing primer GCAAACAACAGATGGCTGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.05.10.653182 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-UbC-CytoTape-vivo-HA was a gift from Changyang Linghu (Addgene plasmid # 250670)
  • For your References section:

    Scalable and multiplexed recorders of gene regulation dynamics across weeks. Zheng L, Shi D, Yan Y, Zhou B, Lim J, Hou Y, An B, Adhinarta JK, Lin M, Ko B, Joesten WC, Gautam M, Huez EDM, Kim EC, Klyder EG, Chang B, Pitchiaya S, Roberts MT, Cai DJ, Boyden ES, Wei D, Lio P, Linghu C. Nature. 2026 Jan 26. doi: 10.1038/s41586-026-10156-9. 10.1038/s41586-026-10156-9 PubMed 41588170