pAAV-hSyn-rtTA3G-TetOn3G
(Plasmid
#250672)
-
PurposeDrive Tet-ON activator expression from human synapsin promoter for doxycycline-inducible transgene activation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250672 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV-hSyn
-
Backbone manufacturerEpoch Life Science, Inc.
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namertTA3G-TetOn3G
-
SpeciesSynthetic
- Promoter hSyn
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aattcgccaccatgtctagactggacaagagcaaagt
- 3′ sequencing primer ggttgattatcgataagcttttacccgggga
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.05.10.653182 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-rtTA3G-TetOn3G was a gift from Changyang Linghu (Addgene plasmid # 250672 ; http://n2t.net/addgene:250672 ; RRID:Addgene_250672) -
For your References section:
Scalable and multiplexed recorders of gene regulation dynamics across weeks. Zheng L, Shi D, Yan Y, Zhou B, Lim J, Hou Y, An B, Adhinarta JK, Lin M, Ko B, Joesten WC, Gautam M, Huez EDM, Kim EC, Klyder EG, Chang B, Pitchiaya S, Roberts MT, Cai DJ, Boyden ES, Wei D, Lio P, Linghu C. Nature. 2026 Jan 26. doi: 10.1038/s41586-026-10156-9. 10.1038/s41586-026-10156-9 PubMed 41588170