Skip to main content
Addgene
Open Menu

pLX403_SMARCB1_W281R
(Plasmid #250673)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 250673 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pLXI_TRC403
  • Backbone size w/o insert (bp) 7742
  • Total vector size (bp) 8900
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SMARCB1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1158
  • Mutation
    Tryptophan 281 to Arginine
  • Entrez Gene
    SMARCB1 (a.k.a. BAF47, CSS3, INI-1, INI1, MRD15, PPP1R144, RDT, RTPS1, SNF5, SNF5L1, SWNTS1, Sfh1p, Snr1, hSNFS)
  • Promoter TRE

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCGAGGTAGGCGTGTACGGTG
  • 3′ sequencing primer GACGTGAAGAATGTGCGAGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLX403_SMARCB1_W281R was a gift from Andrew Hong (Addgene plasmid # 250673 ; http://n2t.net/addgene:250673 ; RRID:Addgene_250673)

  • For your References section:

    SMARCB1 missense mutants disrupt SWI/SNF complex stability and remodeling activity. Cooper GW, Lee BP, Kim WJ, Su Y, Chen VZ, Salas E, Yang X, Lintner RE, Piccioni F, Giacomelli AO, Howard TP, Bagchi P, Conneely KN, Root DE, Liang B, Gumbart JC, Hahn WC, Gorkin DU, Biegel JA, Chi SN, Hong AL. Nat Commun. 2026 Apr 8. doi: 10.1038/s41467-026-71531-8. 10.1038/s41467-026-71531-8 PubMed 41951591
Related items: