Skip to main content

pFZ1036
(Plasmid #250676)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 250676 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTrans230d
  • Total vector size (bp) 23162
  • Vector type
    Plant Expression, CRISPR
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IPT, Cas9, RUBY
  • Promoter CaMV35, AtUbi10

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer 5'ccaatacgcaaaccgcctctcc3'
  • 3′ sequencing primer acgttgtaaaacgacggccagtg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFZ1036 was a gift from Feng Zhang (Addgene plasmid # 250676 ; http://n2t.net/addgene:250676 ; RRID:Addgene_250676)
  • For your References section:

    Developmental regulators enable rapid and efficient soybean transformation and CRISPR-mediated genome editing. Alok A, Raman V, D'Agostino L, Kshetry AO, Rai KM, Wang C, Gunapati S, Stupar RM, Patil GB, Zhang F. Plant Physiol. 2025 Dec 10:kiaf640. doi: 10.1093/plphys/kiaf640. 10.1093/plphys/kiaf640 PubMed 41370232
Commonly requested with: