pFZ1036
(Plasmid
#250676)
-
PurposeIPT along with RUBY for soybean genome editing
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250676 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTrans230d
- Total vector size (bp) 23162
-
Vector typePlant Expression, CRISPR
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIPT, Cas9, RUBY
- Promoter CaMV35, AtUbi10
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer 5'ccaatacgcaaaccgcctctcc3'
- 3′ sequencing primer acgttgtaaaacgacggccagtg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFZ1036 was a gift from Feng Zhang (Addgene plasmid # 250676 ; http://n2t.net/addgene:250676 ; RRID:Addgene_250676) -
For your References section:
Developmental regulators enable rapid and efficient soybean transformation and CRISPR-mediated genome editing. Alok A, Raman V, D'Agostino L, Kshetry AO, Rai KM, Wang C, Gunapati S, Stupar RM, Patil GB, Zhang F. Plant Physiol. 2025 Dec 10:kiaf640. doi: 10.1093/plphys/kiaf640. 10.1093/plphys/kiaf640 PubMed 41370232