pLJM1-Halo-RNaseL
(Plasmid
#250856)
-
Purposelentiviral vector for expressing Halo-tagged RNase L
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250856 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLJM1-puro
- Backbone size w/o insert (bp) 7345
- Total vector size (bp) 10504
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRNASEL
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2220
-
Entrez GeneRNASEL (a.k.a. PRCA1, RNS4)
- Promoter CMV promoter
-
Tag
/ Fusion Protein
- HaloTag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLJM1-Halo-RNaseL was a gift from Britt Glaunsinger (Addgene plasmid # 250856 ; http://n2t.net/addgene:250856 ; RRID:Addgene_250856)