pLJM1-CRS-Halo-NLS
(Plasmid
#250859)
-
Purposelentiviral vector for expressing HaloTag protein tagged with both a GDOWN1 cytoplasmic retention signal (CRS) and a SV40 NLS
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250859 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLJM1-puro
- Backbone size w/o insert (bp) 7345
- Total vector size (bp) 8692
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHaloTag
-
SpeciesH. sapiens (human)
-
Insert Size (bp)363
-
Entrez GenePOLR2M (a.k.a. GCOM1, GRINL1A, Gdown, Gdown1)
- Promoter CMV promoter
-
Tags
/ Fusion Proteins
- GDOWN1 (aa 250-368) (N terminal on insert)
- SV40 NLS (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLJM1-CRS-Halo-NLS was a gift from Britt Glaunsinger (Addgene plasmid # 250859 ; http://n2t.net/addgene:250859 ; RRID:Addgene_250859)