Skip to main content

pZB246-T7-T+
(Plasmid #250903)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 250903 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET29b
  • Backbone size w/o insert (bp) 5288
  • Total vector size (bp) 7973
  • Modifications to backbone
    T7 promoter replaced with pT5-lacUV promoter sequence, T7 terminator replaced
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Thermally Stable T7 RNA Polymerase
  • Alt name
    T7 RNAP
  • Species
    T7 Phage, synthetic
  • Insert Size (bp)
    2685
  • Mutation
    Arginine 31 to Aspartic Acid, Alanine 61 to Arginine, Phenylalanine 105 to Tyrosine, Serine 128 to Lysine, Valine 177 to Histidine, Tyrosine 312 to Aspartic Acid, Lysine 378 to Arginine, Arginine 379 to Lysine, Aspartic Acid 388 to Asparagine, Histidine 411 to Tyrosine, Serine 430 to Proline, Asparagine 433 to Threonine, Phenylalanine 481 to Tryptophan, Glutamic Acid 484 to Aspartic Acid, Serine 495 to Asparagine, Glutamic Acid 498 to Aspartic Acid, Cysteine 510 to Arginine, Asparagine 529 to Valine, Threonine 566 to Lysine, Isoleucine 581 to Glutamine, Serine 606 to Threonine, Alanine 615 to Threonine, Glycine 618 to Glutamine, Serine 633 to Proline, Lysine 713 to Glutamic Acid, Serine 767 to Glycine, Histidine 772 to Arginine, Glutamine 786 to Leucine, Phenylalanine 849 to Isoleucine, Phenylalanine 880 to Tyrosine
  • Promoter pT5-lacUV
  • Tag / Fusion Protein
    • 6xHis (N terminal on backbone)

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer CACGATGCGTCCGGCGTAGAGG
  • 3′ sequencing primer CGAACGTGGCGAGAAAGGAAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZB246-T7-T+ was a gift from Timothy Whitehead (Addgene plasmid # 250903 ; http://n2t.net/addgene:250903 ; RRID:Addgene_250903)
  • For your References section:

    Computational redesign of a thermostable T7 RNA polymerase. Baumer ZT, Whitehead TA. bioRxiv [Preprint]. 2025 Nov 12:2025.11.12.688101. doi: 10.1101/2025.11.12.688101. 10.1101/2025.11.12.688101 PubMed 41292992
Commonly requested with: