Skip to main content

pSB-CMV-MCS-Puro ArfGAP1_ALPS1_ALPS2-mKate2-3NLS-P2A-EGFP-LMNB1
(Plasmid #250908)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 250908 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA 3.1
  • Backbone size w/o insert (bp) 5662
  • Total vector size (bp) 9415
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ArfGAP1-mKate2-3xNLS-P2A-EGFP-Lamin B1
  • Alt name
    ArfGAP1 ALPS1 and ALPS2 domains, Lamin B1
  • Species
    H. sapiens (human), D. rerio (zebrafish)
  • Insert Size (bp)
    3753
  • Mutation
    ARFGAP1 amino acids 192–304 only
  • Entrez Gene
    lmnb1 (a.k.a. fc06g01, wu:fc06g01)
  • Entrez Gene
    ARFGAP1 (a.k.a. ARF1GAP, HRIHFB2281)
  • Promoter CMV
  • Tags / Fusion Proteins
    • mKate2-3xNLS on ArfGAP1 (C terminal on insert)
    • EGFP on LMNB1 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg (CMV-Forward)
  • 3′ sequencing primer tagaaggcacagtcgagg (BGHR)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSB-CMV-MCS-Puro ArfGAP1_ALPS1_ALPS2-mKate2-3NLS-P2A-EGFP-LMNB1 was a gift from Philipp Niethammer (Addgene plasmid # 250908 ; http://n2t.net/addgene:250908 ; RRID:Addgene_250908)
  • For your References section:

    Endoplasmic reticulum disruption stimulates nuclear membrane mechanotransduction. Shen Z, Gelashvili Z, Niethammer P. Nat Cell Biol. 2025 Dec 9. doi: 10.1038/s41556-025-01820-9. 10.1038/s41556-025-01820-9 PubMed 41366519