pSB-CMV-MCS-Puro mCherry-Sec 61B -P2A-EGFP-LMNB1
(Plasmid
#250911)
-
PurposeDual color expression of mCherry tagged human Sec 61B and EGFP tagged zebrafish LaminB1 in mammalian cell lines
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250911 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA 3.1
- Backbone size w/o insert (bp) 5662
- Total vector size (bp) 9262
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry-Sec61B-P2A-EGFP-LMNB1
-
Alt nameSec61B, Lamin B1
-
SpeciesH. sapiens (human), D. rerio (zebrafish)
-
Insert Size (bp)3600
-
Entrez GeneSEC61B
-
Entrez Genelmnb1 (a.k.a. fc06g01, wu:fc06g01)
- Promoter CMV
-
Tags
/ Fusion Proteins
- mCherry on Sec61b (N terminal on insert)
- EGFP on LMNB1 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg (CMV-Forward)
- 3′ sequencing primer tagaaggcacagtcgagg (BGHR)
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSB-CMV-MCS-Puro mCherry-Sec 61B -P2A-EGFP-LMNB1 was a gift from Philipp Niethammer (Addgene plasmid # 250911 ; http://n2t.net/addgene:250911 ; RRID:Addgene_250911) -
For your References section:
Endoplasmic reticulum disruption stimulates nuclear membrane mechanotransduction. Shen Z, Gelashvili Z, Niethammer P. Nat Cell Biol. 2025 Dec 9. doi: 10.1038/s41556-025-01820-9. 10.1038/s41556-025-01820-9 PubMed 41366519