Skip to main content

pSB-CMV-MCS-Puro mCherry-Sec 61B -P2A-EGFP-LMNB1
(Plasmid #250911)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 250911 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA 3.1
  • Backbone size w/o insert (bp) 5662
  • Total vector size (bp) 9262
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry-Sec61B-P2A-EGFP-LMNB1
  • Alt name
    Sec61B, Lamin B1
  • Species
    H. sapiens (human), D. rerio (zebrafish)
  • Insert Size (bp)
    3600
  • Entrez Gene
    SEC61B
  • Entrez Gene
    lmnb1 (a.k.a. fc06g01, wu:fc06g01)
  • Promoter CMV
  • Tags / Fusion Proteins
    • mCherry on Sec61b (N terminal on insert)
    • EGFP on LMNB1 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg (CMV-Forward)
  • 3′ sequencing primer tagaaggcacagtcgagg (BGHR)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSB-CMV-MCS-Puro mCherry-Sec 61B -P2A-EGFP-LMNB1 was a gift from Philipp Niethammer (Addgene plasmid # 250911 ; http://n2t.net/addgene:250911 ; RRID:Addgene_250911)
  • For your References section:

    Endoplasmic reticulum disruption stimulates nuclear membrane mechanotransduction. Shen Z, Gelashvili Z, Niethammer P. Nat Cell Biol. 2025 Dec 9. doi: 10.1038/s41556-025-01820-9. 10.1038/s41556-025-01820-9 PubMed 41366519